View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21097_high_76 (Length: 272)
Name: NF21097_high_76
Description: NF21097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21097_high_76 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 14 - 272
Target Start/End: Complemental strand, 33768523 - 33768265
Alignment:
| Q |
14 |
gaacaaagatgatgggaagaaagtgagagttcttgaattggttaattgggacccacttttggcggttagcgcgattgaaaaggagttcatggtgaatgag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33768523 |
gaacaaagatgatgggaagaaagtgagagttcttgaattggttaattgggacccgcttttggcggttagcgcgattgaaaaggagttcatggtgaatgag |
33768424 |
T |
|
| Q |
114 |
gatgatgctaagaggaaatttacttttcctgtgaagcatgggaaggatttggaattgggaattgaggatgagaggaagatgaatttgttaaatgcgttac |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33768423 |
gatgatgctaagaggaaatttacttttcctgtgaagcatgggaaggatttggaattgggaattgaggatgagaggaagatgaatttgttaaatgcgttac |
33768324 |
T |
|
| Q |
214 |
cgttggtttcgccttattctgatggggcgaagtttgatgtgtggacattggaagctgag |
272 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33768323 |
cgttggtttcgccttattcggatggggcgaagtttgatgtgtggacattggaagctgag |
33768265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University