View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21097_low_101 (Length: 243)
Name: NF21097_low_101
Description: NF21097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21097_low_101 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 15 - 224
Target Start/End: Original strand, 46372473 - 46372682
Alignment:
| Q |
15 |
caaaggaagaagaaggggaagaggtggtagaaaatctgatcaaggagaaattttgacgagacccagttcaagaccatgtactgaaataacaagtgctata |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46372473 |
caaaggaagaagaaggggaagaggtggtagaaaatctgatcaaggagaaattttgacgagacccagttcaagaccatgtactgaaataacaagtgctata |
46372572 |
T |
 |
| Q |
115 |
aatggaaatgttgaaaatggttacaactctggtgacattgatgttggttttcctacttcaagcaagtctatgaactttactcgtagacctggatttggac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46372573 |
aatggaaatgttgaaaatggttacaactctggtgacattgatgttggttttcctacttcaagcaagtctatgaactttactcgtagacctggatttggac |
46372672 |
T |
 |
| Q |
215 |
aagttgggac |
224 |
Q |
| |
|
|||||||||| |
|
|
| T |
46372673 |
aagttgggac |
46372682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University