View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21097_low_103 (Length: 239)
Name: NF21097_low_103
Description: NF21097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21097_low_103 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 18 - 237
Target Start/End: Complemental strand, 7947016 - 7946789
Alignment:
| Q |
18 |
ttaagattgtagtctcaccactaagctaacgcctcatggacaaacaataggttttaagtctcatattgactagagatcaggcctggagataagaaccaac |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7947016 |
ttaagactgtagtctcaccactaagctaacgcctcatggacaaacaataggttttaagtctcatattgactagagatcaggcctggagataagaaccaac |
7946917 |
T |
 |
| Q |
118 |
cgttttaaaagccggttttgtgggattggattacacccgaaatttaatcta--------tgtnnnnnnnncaataacaatgtatttgtaattggaatttg |
209 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
7946916 |
cgttttaaaagccagttttgtgggattggattacacccgaaatttaatctatgtaaaattgtaaaaaaaacaataacaatgtatttgtaattggaatttg |
7946817 |
T |
 |
| Q |
210 |
gaaatatacatgtatatttttcgacatc |
237 |
Q |
| |
|
||||||||||||||| ||||| |||||| |
|
|
| T |
7946816 |
gaaatatacatgtatgtttttggacatc |
7946789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University