View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21097_low_109 (Length: 221)
Name: NF21097_low_109
Description: NF21097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21097_low_109 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 19 - 198
Target Start/End: Complemental strand, 33768260 - 33768081
Alignment:
| Q |
19 |
atagggttggattgattcatgagtttttgagtttgacattggagaagagagcttcaattcatcatcttgttgagtttaaggaggagtttagtttgactaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33768260 |
atagggttggattgattcatgagtttttgagtttgacattggagaagagagcttcaattcatcatcttgttgagtttaaggaggagtttagtttgactaa |
33768161 |
T |
|
| Q |
119 |
gcatacttatcatatgttggttaagcagccgagggcgttttatttggcggggactgagatgaattgggttgtgtttttga |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33768160 |
gcatacttatcatatgttggttaagcagccgagggcgttttatttggcggggactgagatgaattgggttgtgtttttga |
33768081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University