View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21097_low_110 (Length: 216)
Name: NF21097_low_110
Description: NF21097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21097_low_110 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 18 - 203
Target Start/End: Original strand, 29206651 - 29206836
Alignment:
| Q |
18 |
gtggcaagtttgtagagaatgttttcctactcgagtacggctgcctagaagaggtgtatactgtccgtctacgtgtgtaatgtgtaacgacccacacgaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29206651 |
gtggcaagtttgtagagaatgttttcctactcgagtacggctgcctagaagaggtgtatactgtccgtctacgtgtgtaatgtgtaacgacccacacgaa |
29206750 |
T |
 |
| Q |
118 |
gatagttatcannnnnnnnnccagtgctgtacagaagttagtgcttggagagctgctggtgtttggcaattaattgagcctttgct |
203 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
29206751 |
gatagttatcatttttttttccagtgctgtacagcagttagtgcttggagagctgctggagtttggcatttaattgagcctttgct |
29206836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University