View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21097_low_33 (Length: 458)
Name: NF21097_low_33
Description: NF21097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21097_low_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 1e-66; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 308 - 440
Target Start/End: Original strand, 25540570 - 25540702
Alignment:
| Q |
308 |
ttagatcaaaaagtttatttataagtaggaggaataccttactttataaacccttattttaaggagttataaactggttatgtatggttgcatatgattc |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25540570 |
ttagatcaaaaagtttatttataagtaggaggaataccttactttataaacccttattttaaggagttataaaccggttatgtatggttgcatatgattc |
25540669 |
T |
|
| Q |
408 |
aatccacattttaattaggaggcataccttacc |
440 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
25540670 |
aatccacattttaattaggaggcataccttacc |
25540702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 65 - 120
Target Start/End: Complemental strand, 16485987 - 16485932
Alignment:
| Q |
65 |
tctctatgttagcctatcatgcgtaacgagcacaagattactaactcttaactaat |
120 |
Q |
| |
|
||||||||||||| ||||||| ||||| | |||||||| ||||||||||||||||| |
|
|
| T |
16485987 |
tctctatgttagcttatcatgtgtaacaaacacaagatcactaactcttaactaat |
16485932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 62 - 119
Target Start/End: Complemental strand, 19242538 - 19242481
Alignment:
| Q |
62 |
gtgtctctatgttagcctatcatgcgtaacgagcacaagattactaactcttaactaa |
119 |
Q |
| |
|
|||||||||||||||| ||| ||| ||||| | |||||| ||| |||||||||||||| |
|
|
| T |
19242538 |
gtgtctctatgttagcttattatgtgtaacaaacacaagcttattaactcttaactaa |
19242481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University