View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21097_low_54 (Length: 370)
Name: NF21097_low_54
Description: NF21097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21097_low_54 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 4e-91; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 1 - 182
Target Start/End: Complemental strand, 20670451 - 20670270
Alignment:
| Q |
1 |
tcatcgtgacttgacagctcattgttcaccgacacattagcaaaaaatgaacctaaaatgcagtggtagagaaaatttctgaaatttaaaaatttgatga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20670451 |
tcatcgtgacttgacagctcattgttcaccgacacatcagcaaaaaataaacctaaaatgcagtggtagagaaaatttctgaaatttaaaaatttgatga |
20670352 |
T |
|
| Q |
101 |
ctatattcttcgatctagaaatatagagaccaaaatcgttaatcaacgaaaataaggagatcaaaagtgtaattaagtcatt |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
20670351 |
ctatattcttcgatctagaaatatagagaccaaaatcgttaatcaacgaaaataaggagatcaaaagtgtatttaagtcatt |
20670270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 250 - 351
Target Start/End: Complemental strand, 20670202 - 20670101
Alignment:
| Q |
250 |
agatttagacatacttggcgaagtcttcgggcttcttgcttagaccaaaaggatcataaccgtagctgcatagacaaacataaacatgttaagcaaaaga |
349 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20670202 |
agatttagacatacttggcaaagtcttcgggcttcttgcttagaccaaaaggatcataaccgtagctgcatagacacacataaacatgttaagcaaaaga |
20670103 |
T |
|
| Q |
350 |
ag |
351 |
Q |
| |
|
|| |
|
|
| T |
20670102 |
ag |
20670101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University