View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21097_low_67 (Length: 325)
Name: NF21097_low_67
Description: NF21097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21097_low_67 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 126 - 308
Target Start/End: Complemental strand, 20146984 - 20146801
Alignment:
| Q |
126 |
ccctttgttactatctttatttttggccgtgttttacccgatgacacttaatattgtttcaactttgaagattatctgtttacacaaacaaacaaaatta |
225 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
20146984 |
ccctctgttactatctttatttctggccgtgttttacacgatggcacttaatattgtttcaactttgaagattattcgtttacgcaaacaaacaaaattg |
20146885 |
T |
 |
| Q |
226 |
ttgtgattaaag--ttactaaaatgacataacccagtcctctagatgtcctttacctgcgtcgtgagcccaagacttcaatcacc |
308 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20146884 |
ttgtgattaaagttttactaaaatgacataa-ccagtcctctagatgtcctttacctgcgtcgtgagccccagacttcaatcacc |
20146801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 128; Significance: 4e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 124 - 308
Target Start/End: Complemental strand, 25100660 - 25100475
Alignment:
| Q |
124 |
ttccctttgttactatctttatttttggccgtgttttacccgatgacacttaatattgtttcaactttgaagattatctgtttacacaaacaaacaaaat |
223 |
Q |
| |
|
|||||| |||||||||| |||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25100660 |
ttccctctgttactatcattatttctggccgtgttttacacgatggcacttaatattgtttcaactttgaagattattcgtttacacaaacaaacaaaat |
25100561 |
T |
 |
| Q |
224 |
tattgtgattaaag--ttactaaaatgacataacccagtcctctagatgtcctttacctgcgtcgtgagcccaagacttcaatcacc |
308 |
Q |
| |
|
| |||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25100560 |
tgttgtgattaaagttttactaaaatgacataa-ccagtcctctagatgtcctttacctgcgtcgtgagcccctgacttcaatcacc |
25100475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University