View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21097_low_72 (Length: 296)
Name: NF21097_low_72
Description: NF21097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21097_low_72 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 15 - 279
Target Start/End: Original strand, 27974625 - 27974889
Alignment:
| Q |
15 |
tattgggaaatcgaagatcagataacaggtatgcagaaacatgtttgcagtttgcaagatgaatttggtgtcggtactgtcattgaagacgacgatgcta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27974625 |
tattgggaaatcgaagatcagataacaggtatgcagaaacatgtttgcagtttgcaagatgaatttggcgtcggtactgtcattgaagacgacgatgcta |
27974724 |
T |
|
| Q |
115 |
gagctttaatggcagcaacggcactgaaatcgtgtcaagagacgctttcaaagttgcaaaagattcaagcacaatcatcagtagaagctaaagttgaata |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27974725 |
gagctttaatggcagcaacggcactgaaatcatgtcaagagacgctttcaaagttgcaaaagattcaagcacagtcatcagtagaagctaaagttgaata |
27974824 |
T |
|
| Q |
215 |
tgaaagagttaaaaaagctcatgagatgtttgagaatcttagagatcaattcatcactaaattca |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27974825 |
tgaaagagttaaaaaagctcatgagatgtttgagaatcttagagatcaattcatcactaaattca |
27974889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 57 - 136
Target Start/End: Complemental strand, 46041708 - 46041629
Alignment:
| Q |
57 |
gtttgcagtttgcaagatgaatttggtgtcggtactgtcattgaagacgacgatgctagagctttaatggcagcaacggc |
136 |
Q |
| |
|
|||||||||||||||||||| ||| || || |||| || |||||||| |||| || |||||||||||||||| ||||| |
|
|
| T |
46041708 |
gtttgcagtttgcaagatgagtttagtatcagtacagtaattgaagataacgacgcacgagctttaatggcagccacggc |
46041629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University