View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21097_low_79 (Length: 272)

Name: NF21097_low_79
Description: NF21097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21097_low_79
NF21097_low_79
[»] chr3 (1 HSPs)
chr3 (14-272)||(33768265-33768523)


Alignment Details
Target: chr3 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 14 - 272
Target Start/End: Complemental strand, 33768523 - 33768265
Alignment:
14 gaacaaagatgatgggaagaaagtgagagttcttgaattggttaattgggacccacttttggcggttagcgcgattgaaaaggagttcatggtgaatgag 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
33768523 gaacaaagatgatgggaagaaagtgagagttcttgaattggttaattgggacccgcttttggcggttagcgcgattgaaaaggagttcatggtgaatgag 33768424  T
114 gatgatgctaagaggaaatttacttttcctgtgaagcatgggaaggatttggaattgggaattgaggatgagaggaagatgaatttgttaaatgcgttac 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33768423 gatgatgctaagaggaaatttacttttcctgtgaagcatgggaaggatttggaattgggaattgaggatgagaggaagatgaatttgttaaatgcgttac 33768324  T
214 cgttggtttcgccttattctgatggggcgaagtttgatgtgtggacattggaagctgag 272  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
33768323 cgttggtttcgccttattcggatggggcgaagtttgatgtgtggacattggaagctgag 33768265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University