View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21097_low_82 (Length: 266)
Name: NF21097_low_82
Description: NF21097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21097_low_82 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 17351554 - 17351309
Alignment:
| Q |
1 |
tatattattgcattatttttattgatatgaaaaagtgtgtcatggggtgtccatagaggtatattgtggaaggatcaagaagagagaaatttgtgttgct |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
17351554 |
tatattattgcataatttttattgatatgaaaaagtgtgtcatagggtgtccatagaggtatattgtggaaggatcaagaagagagaaatttgtgttact |
17351455 |
T |
 |
| Q |
101 |
agattcgactaatcgaacaagagtatagtattttaacaactcaaaatcagggtgagcacacatggtagatgtacatggtatgtcattgtatataatttat |
200 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
17351454 |
agattcgactaatcgaagacgagtatagtattttaacaactcaaaatcagggtgagcacacatggtagatgtaaatggtatgtcattgcatataatttat |
17351355 |
T |
 |
| Q |
201 |
gataggacaatatatcattgtttgatccatgtgatttatcccatct |
246 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
17351354 |
gataggacaatatatcatcgtttgatccatgtgatttatctcatct |
17351309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University