View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21097_low_85 (Length: 255)
Name: NF21097_low_85
Description: NF21097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21097_low_85 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 13 - 239
Target Start/End: Original strand, 27448813 - 27449039
Alignment:
| Q |
13 |
tgaacgccttgctgaaaatatactaaatgaagtgagattcttattcacattcacttttaattcatgcatttgtatctatgaaacgctgacacagatacca |
112 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27448813 |
tgaacgccttgctgaaaatatcctaaatgaagtgagattcttattcacattcacttttaattcatgcatttgtatctatgaaacgctgacacagatacca |
27448912 |
T |
|
| Q |
113 |
aacatgatactcatagttaaacaagtagcattgatgcttaacgggatttgcagttggtatatcagtcaacaacttagatttgttgtcgaaaaagttattg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27448913 |
aacatgatactcatagttaaacaagtagcattgatgcttaatgtgatttgcagttggtatatccatcaaccacttagatttgttgtcgaaaaagttattg |
27449012 |
T |
|
| Q |
213 |
ttcaaattacacaattgttctagttat |
239 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
27449013 |
ttcaaattacacaattgttctagttat |
27449039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University