View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21097_low_95 (Length: 248)
Name: NF21097_low_95
Description: NF21097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21097_low_95 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 46 - 248
Target Start/End: Complemental strand, 13524795 - 13524593
Alignment:
| Q |
46 |
ctcaatatttaatatgtgtgaattttatagttatgttctttatcatttaaaatacaacttgtattattttttaaatcaataaataaattatggagctaat |
145 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13524795 |
ctcaatatttaatatgtatgaattttatagttatgttttttatcatttaaaatacaacttgtattattttttaaatcaataaataaattatggagctaat |
13524696 |
T |
 |
| Q |
146 |
attttcaaaagagtgttttcaactcaatgatatataacctcggaattcaaggacggccaagtttcaaaattggcaacctatgcatatcattttatgcttt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13524695 |
attttcaaaagagtgttttcaactcaatgatatataacctcggaattcaaggacggccaagtttcaaaattggctacctatgcatatcattttatgcttt |
13524596 |
T |
 |
| Q |
246 |
cac |
248 |
Q |
| |
|
||| |
|
|
| T |
13524595 |
cac |
13524593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University