View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21097_low_98 (Length: 247)
Name: NF21097_low_98
Description: NF21097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21097_low_98 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 77; Significance: 7e-36; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 8783662 - 8783763
Alignment:
| Q |
1 |
atgattgatatttatcttacattacaattgaacnnnnnnncctaagtttttaaataatcggtaagactttcgagttatggttcaattcgtacaaccccat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8783662 |
atgattgatatttatcttacattacaattgaactttttttcctaagtttttaaataatcggtaagacttttgagttatggttcaattcgtacaaccccat |
8783761 |
T |
 |
| Q |
101 |
tt |
102 |
Q |
| |
|
|| |
|
|
| T |
8783762 |
tt |
8783763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 165 - 233
Target Start/End: Original strand, 8783831 - 8783899
Alignment:
| Q |
165 |
gaatcaacccgagttcaatcgggttaactagattgtggttcagctgagatcaaaccaaccagcaaactg |
233 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8783831 |
gaatcaacccttgttcaatcgggttaactagattgtggttcagttgagatcaaaccaaccagcaaactg |
8783899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 17 - 99
Target Start/End: Complemental strand, 7110954 - 7110872
Alignment:
| Q |
17 |
ttacattacaattgaacnnnnnnncctaagtttttaaataatcggtaagactttcgagttatggttcaattcgtacaacccca |
99 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| | || |||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
7110954 |
ttacattacaattgaacattttttcctaagtttttaaataaccagtgagactttcaagtcatggttcaattcgtacaacccca |
7110872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University