View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21098_low_6 (Length: 300)
Name: NF21098_low_6
Description: NF21098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21098_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 17 - 286
Target Start/End: Complemental strand, 51804308 - 51804039
Alignment:
| Q |
17 |
ttgtggcggttaagaggctttggagtcgaagttcgaaggattcttcgccagaagatgcattatttgtggacaaggcattgaaagctgaggtggaaacact |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51804308 |
ttgtggcggttaagaggctttggagtcgaagttcgaaggattcttcgccagaagatgcattatttgtggacaaggcattgaaagctgaggtggaaacact |
51804209 |
T |
|
| Q |
117 |
tggaagcataagacacaagaacattgttaagttgtattgttgcttctcaagtttggattgtagcttgttggtttatgagtatatgccaaatggtactttg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51804208 |
tggaagcataagacacaagaacattgttaagttgtattgttgcttctcaagtttggattgtagcttgttggtttatgagtatatgccaaatggtactttg |
51804109 |
T |
|
| Q |
217 |
tatgattctcttcataagggttggattcatttggattggcctacaaggtataggattgcacttggaattg |
286 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51804108 |
tatgattctcttcacaagggttggattcatttggattggcctacaaggtataggattgcacttggaattg |
51804039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 66 - 242
Target Start/End: Complemental strand, 36578764 - 36578580
Alignment:
| Q |
66 |
agaagatgcattatttgtggacaaggcattgaaagctgaggtggaaacacttgg-aagcataagacacaagaacattgttaagttgta---ttgttgctt |
161 |
Q |
| |
|
||||||| |||||||| ||||||||| |||| || ||||| || |||||||| ||| |||| |||||||||||| ||| || | ||||||||| |
|
|
| T |
36578764 |
agaagataaattatttgcggacaaggcgttgagggcagaggtagagacacttgggaagtataaaacacaagaacatgtttatcttattctgttgttgctt |
36578665 |
T |
|
| Q |
162 |
ctcaagtttggattgtagcttgttggttt----atgagtatatgccaaatggtactttgtatgattctcttcataagggttggat |
242 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||| ||||||||||||||||| |||||||| ||||| ||| ||||||| |
|
|
| T |
36578664 |
ctcaattttggattgtagcttgttggtttgtttatgagtacatgccaaatggtactttatatgattcacttcacaagagttggat |
36578580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University