View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21099_low_12 (Length: 215)

Name: NF21099_low_12
Description: NF21099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21099_low_12
NF21099_low_12
[»] chr4 (1 HSPs)
chr4 (8-126)||(51821825-51821943)


Alignment Details
Target: chr4 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 8 - 126
Target Start/End: Original strand, 51821825 - 51821943
Alignment:
8 gaacctgtggagtaataagagcagggtgttggtagagagagtgttgctcaatcattggattctgcctaaacttctgtggcaacatcttcagttctagggt 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51821825 gaacctgtggagtaataagagcagggtgttggtagagagagtgttgctcaatcattggattctgcctaaacttctgtggcaacatcttcagttctagggt 51821924  T
108 tagggtttgaagaggtaat 126  Q
    |||||||||||||||||||    
51821925 tagggtttgaagaggtaat 51821943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University