View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21099_low_7 (Length: 270)
Name: NF21099_low_7
Description: NF21099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21099_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 96; Significance: 4e-47; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 109 - 251
Target Start/End: Original strand, 2265645 - 2265787
Alignment:
| Q |
109 |
cctaggattaatttatattctattttttcaatattctcatagaacaagttctcatgaacgataatttcgaaattaaaattgnnnnnnnnnnnnngaaaaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2265645 |
cctaggattaatttatattctattttttcaatattctcattgaacaagttctcatgaacgataatttcgaaattaaaattgtttttatttttttgaaaaa |
2265744 |
T |
|
| Q |
209 |
accgaaggaaaacaacatttcctttagctgcaaaccaactcat |
251 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2265745 |
accgaaggaaaacaacatttccttaagctgcaaaccaactcat |
2265787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University