View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2109_low_10 (Length: 287)
Name: NF2109_low_10
Description: NF2109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2109_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 18 - 277
Target Start/End: Original strand, 36457244 - 36457503
Alignment:
| Q |
18 |
gctgtcagcgtctccaaggcaggaccagcctgatactgggtctggaaactagaatctacgcagagattcagctgcaaaagctgatgtagaatgctgtcag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36457244 |
gctgtcagcgtctccaaggcaggaccagcctgatactgggtctggaaactagagtctacacagagattcagctgcaaaagctgatgtagaatgctgtcag |
36457343 |
T |
 |
| Q |
118 |
atttatatgcaggcgacgagtttagagcagcatatcacctaatttggcgatgtgtcgaaagtccaggttttcgggtggaagctcctgcagaagaggctgc |
217 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36457344 |
atttatatgcaggcgacgagtttaaagtagcatatcacctaatttggcgatgtgtcgaaagtccaggttttcgtgtggaagctcctgcagaagaggctgc |
36457443 |
T |
 |
| Q |
218 |
agtcaatgttgaatttaatcacaagaaacattatgcctgcggatcataattcatcctttg |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36457444 |
agtcaatgttgaatttaatcacaagaaacattatgcctgcggatcataattcatcctttg |
36457503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University