View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2109_low_11 (Length: 254)
Name: NF2109_low_11
Description: NF2109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2109_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 13 - 233
Target Start/End: Original strand, 34285197 - 34285419
Alignment:
| Q |
13 |
tcaaaaacagctaattgttgcatacatgttataggaatcactgtcacaagcattaacgttgcatgtgagcttcacaagtattgtcttcaaatactgtaac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34285197 |
tcaaaaacagctaattgttgcatacatgttataggaatcactgtcacaagcattaacgttgcatgtgagcttcacaagtattgtcttcaaatactgtaac |
34285296 |
T |
 |
| Q |
113 |
aattgcttcttataataatctgcatctagaattataataaat--tgnnnnnnnnnnnnnngttactaattttacgtaccactagtacaaacattatcaag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34285297 |
aattgcttcttataataatctgcatctagaattataataaattgtgtatatatatatatagttactaattttacgtaccactagtacaaacattatcaag |
34285396 |
T |
 |
| Q |
211 |
tcttccaacattaatctgttcat |
233 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
34285397 |
tcttccaacattaatctgttcat |
34285419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University