View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2109_low_13 (Length: 242)
Name: NF2109_low_13
Description: NF2109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2109_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 5947236 - 5946995
Alignment:
| Q |
1 |
ccgttcaaaaaaccgttattccctccgaaacagatcggaaaattacttccaccgtc------gccggtaagcgatccacttctcattcgtttttcatttc |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5947236 |
ccgttcaaaaaaccgttattccctccgaaacagatcggaaaattacttccaccgtcaccgtcgccggtaagcgatccacttctcattcgtttttcatttc |
5947137 |
T |
|
| Q |
95 |
ttgtatcaacgccgctatcatgcttctgcattgtttacaaatcacctcaatctgttgcatcaatgaaaactccattttcagatctctctgtttaatttcc |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5947136 |
ttgtatcaacgccgctatcatgcttctgcattgtttacaaatcacctcaatctgttgcatcaatgaaaactccattttcagatctctctgtttaatttcc |
5947037 |
T |
|
| Q |
195 |
aatgctcatgtttttgcactgttttgattcgattcatctcac |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5947036 |
aatgctcatgtttttgcactgttttgattcgattcatttcac |
5946995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University