View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2109_low_14 (Length: 242)
Name: NF2109_low_14
Description: NF2109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2109_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 13 - 226
Target Start/End: Complemental strand, 51641695 - 51641496
Alignment:
| Q |
13 |
tcaaccgagggtttgtttaaagtactccccattagttaattaattagggaaggaagcgttacatgaaagtgttaggaacattattttaatcaacattgtc |
112 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51641695 |
tcaaccgcgggtttgtttaaagtactccccattagttaattaattagggaaggaatcgttacatgaaagtgttaggaacattattttaatcaacattgtc |
51641596 |
T |
 |
| Q |
113 |
aaacaataattccttagttttgatactggtcttcaaaagnnnnnnnnnnncattgttaaattttgcaattttactctctaattttagtcttcacttttta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51641595 |
aaacaataattccttagttttgatactggtcttcaa--------------cattgttaaattttgcaattttactctctaattttagtcttcacttttta |
51641510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University