View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2109_low_16 (Length: 210)
Name: NF2109_low_16
Description: NF2109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2109_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 3e-96; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 17 - 194
Target Start/End: Complemental strand, 36332071 - 36331894
Alignment:
| Q |
17 |
aagaaagccaaaatatactcaaaggtaatggttgaactcctggaacagcatcaagcatgttattgtctctagctacattttttcttttcacttctatgat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36332071 |
aagaaagccaaaatatactcaaaggtaatggttgaactcctggaacagcatcaagcatgttattgtctctagctacattttttcttttcacttctatgat |
36331972 |
T |
 |
| Q |
117 |
tgctgcaattgccatcgagatgcaggatagtattaggccgacacctatgcgctgcaggtgcgtgactccggttggtat |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36331971 |
tgctgcaattgccatcgagatgcaggatagtattaggccgacacctatgcgctgcaggtgcgtgactccggttggtat |
36331894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 17 - 194
Target Start/End: Complemental strand, 36324810 - 36324633
Alignment:
| Q |
17 |
aagaaagccaaaatatactcaaaggtaatggttgaactcctggaacagcatcaagcatgttattgtctctagctacattttttcttttcacttctatgat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36324810 |
aagaaagccaaaatatactcaaaggtaatggttgaactcctggaacagcatcaagcatgttattatctctagctacattttttcttttcacttctatgat |
36324711 |
T |
 |
| Q |
117 |
tgctgcaattgccatcgagatgcaggatagtattaggccgacacctatgcgctgcaggtgcgtgactccggttggtat |
194 |
Q |
| |
|
||| || |||||||||||||||||||||||||||||||| || ||||| ||||||| ||| || | ||||||||||| |
|
|
| T |
36324710 |
tgccgcgattgccatcgagatgcaggatagtattaggccaacgcctattcgctgcaagtgagtaatgccggttggtat |
36324633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University