View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2109_low_8 (Length: 319)
Name: NF2109_low_8
Description: NF2109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2109_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 123 - 275
Target Start/End: Complemental strand, 43498726 - 43498574
Alignment:
| Q |
123 |
gattgcgtgaaccgtaaattttgttgcataattaaaactaaacaagattcagatgtatatatcatgcctcatactagaataaatcattcattgttctagg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43498726 |
gattgcgtgaaccgtaaattttgttgcataattaaaactaaacaagattcagatgtatatatcatgcctcatactagaataaatcattcattgttctagg |
43498627 |
T |
|
| Q |
223 |
ttcatacagtttaatcattcctattaaataaaaacattgttgtaaacaatgag |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43498626 |
ttcatacagtttaatcattcctattaaataaaaacattgttgcaaacaatgag |
43498574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 43498885 - 43498840
Alignment:
| Q |
1 |
atttgtactattggtgtaaaacatgatctaattatttactcctaaa |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43498885 |
atttgtactattggtgtaaaacatgatctaattatttactcctaaa |
43498840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University