View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2109_low_8 (Length: 319)

Name: NF2109_low_8
Description: NF2109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2109_low_8
NF2109_low_8
[»] chr7 (2 HSPs)
chr7 (123-275)||(43498574-43498726)
chr7 (1-46)||(43498840-43498885)


Alignment Details
Target: chr7 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 123 - 275
Target Start/End: Complemental strand, 43498726 - 43498574
Alignment:
123 gattgcgtgaaccgtaaattttgttgcataattaaaactaaacaagattcagatgtatatatcatgcctcatactagaataaatcattcattgttctagg 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43498726 gattgcgtgaaccgtaaattttgttgcataattaaaactaaacaagattcagatgtatatatcatgcctcatactagaataaatcattcattgttctagg 43498627  T
223 ttcatacagtttaatcattcctattaaataaaaacattgttgtaaacaatgag 275  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||    
43498626 ttcatacagtttaatcattcctattaaataaaaacattgttgcaaacaatgag 43498574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 43498885 - 43498840
Alignment:
1 atttgtactattggtgtaaaacatgatctaattatttactcctaaa 46  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
43498885 atttgtactattggtgtaaaacatgatctaattatttactcctaaa 43498840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University