View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21100_high_16 (Length: 407)
Name: NF21100_high_16
Description: NF21100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21100_high_16 |
 |  |
|
| [»] scaffold0329 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 10 - 226
Target Start/End: Complemental strand, 49732 - 49516
Alignment:
| Q |
10 |
agaagaaatcaagacttattggagtttgtttatggcgtttgaaaagtctatgaggatggttgaacaatggatatttggaaggtgtataaattttcatgcc |
109 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |
|
|
| T |
49732 |
agaagaactcaagacttattggagtttgtttatggcgtttgaaaagtctatgaggatggttgagcaatggatatttggaaggtgtataaattttcatacc |
49633 |
T |
 |
| Q |
110 |
atgagccgtgcatgtcaccaccctgatggtctggtttgtgttactaatgagacatgggaatttaagagccacattctacatgtttcaaaaccatctagaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
49632 |
atgagccgtgcatgtcaccaccctgatggtctggtttgtgttactaatgagacatgagagtttaagagccacattctacatatttcaaaaccaactagaa |
49533 |
T |
 |
| Q |
210 |
aagaccctgatactctt |
226 |
Q |
| |
|
||||||||||| ||||| |
|
|
| T |
49532 |
aagaccctgatgctctt |
49516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 347 - 390
Target Start/End: Complemental strand, 49524 - 49481
Alignment:
| Q |
347 |
gatgctcttatcatgtggatgctaagccgatttatataggagct |
390 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49524 |
gatgctcttatcatgtggatgctaagccgatttatataggagct |
49481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0329 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0329
Description:
Target: scaffold0329; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 27 - 127
Target Start/End: Original strand, 16492 - 16591
Alignment:
| Q |
27 |
attggagtttgtttatggcgtttgaaaagtctatgaggatggttgaacaatggatatttggaaggtgtataaattttcatgccatgagccgtgcatgtca |
126 |
Q |
| |
|
||||||||||||||||||| || || || || ||||||| ||| |||||||||| ||||||| |||||| | |||||||| |||||| ||| | ||||| |
|
|
| T |
16492 |
attggagtttgtttatggctttggaggagactttgaggat-gttaaacaatggatgtttggaatgtgtatgagttttcatgtcatgagtcgttcttgtca |
16590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 27 - 108
Target Start/End: Complemental strand, 19287733 - 19287652
Alignment:
| Q |
27 |
attggagtttgtttatggcgtttgaaaagtctatgaggatggttgaacaatggatatttggaaggtgtataaattttcatgc |
108 |
Q |
| |
|
|||||||||| |||||||| || || ||||| ||||||||||| |||||||||| | || || |||||| | ||||||||| |
|
|
| T |
19287733 |
attggagtttatttatggctttggaggagtctttgaggatggttaaacaatggatgtgtgaaatgtgtatgagttttcatgc |
19287652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University