View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21100_high_28 (Length: 285)

Name: NF21100_high_28
Description: NF21100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21100_high_28
NF21100_high_28
[»] chr4 (3 HSPs)
chr4 (36-267)||(49484155-49484386)
chr4 (33-106)||(55072058-55072131)
chr4 (168-216)||(55072199-55072247)


Alignment Details
Target: chr4 (Bit Score: 144; Significance: 9e-76; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 36 - 267
Target Start/End: Complemental strand, 49484386 - 49484155
Alignment:
36 gaaaatcaacttgataagctcggatggggatgtgtttgaagttgattacgatgttgcacttatgtcaaaaacaatccaggatgctatggagatcaatcct 135  Q
    ||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||  |||||||||| ||||   |||||    
49484386 gaaaatcaacttgataagctcggatggggatatgtttgaagttgactacgatgttgcacttatgtcaaaaacaattgaggatgctattgagacagatcct 49484287  T
136 gctggtgatatcaatagcatttctctttctttagtgaatagcgaattgttgaccaaggtcattgaatactgcaagaagcacaagaacacacaaatgtcag 235  Q
     |||||||| | ||| | ||||||||||||||||||| |||| || | ||| ||| ||||||||||||||||||||||||||||||| ||||||||||||    
49484286 actggtgatgttaattgtatttctctttctttagtgagtagcaaaatattggccatggtcattgaatactgcaagaagcacaagaacgcacaaatgtcag 49484187  T
236 atgttgatctcaaggattaggatgttgaattc 267  Q
    |||||||||||| ||||| |||||||||||||    
49484186 atgttgatctcatggattgggatgttgaattc 49484155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 33 - 106
Target Start/End: Original strand, 55072058 - 55072131
Alignment:
33 aaagaaaatcaacttgataagctcggatggggatgtgtttgaagttgattacgatgttgcacttatgtcaaaaa 106  Q
    ||||||| |||||||| |||||||||| |||| |||||||||||||||||  | | | ||||||||||||||||    
55072058 aaagaaagtcaacttggtaagctcggacggggttgtgtttgaagttgatttgggtttggcacttatgtcaaaaa 55072131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 168 - 216
Target Start/End: Original strand, 55072199 - 55072247
Alignment:
168 agtgaatagcgaattgttgaccaaggtcattgaatactgcaagaagcac 216  Q
    |||||||||| || |||||| || |||| ||||||||||||||||||||    
55072199 agtgaatagcaaaatgttgagcatggtcgttgaatactgcaagaagcac 55072247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University