View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21100_high_28 (Length: 285)
Name: NF21100_high_28
Description: NF21100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21100_high_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 9e-76; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 36 - 267
Target Start/End: Complemental strand, 49484386 - 49484155
Alignment:
| Q |
36 |
gaaaatcaacttgataagctcggatggggatgtgtttgaagttgattacgatgttgcacttatgtcaaaaacaatccaggatgctatggagatcaatcct |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |||| ||||| |
|
|
| T |
49484386 |
gaaaatcaacttgataagctcggatggggatatgtttgaagttgactacgatgttgcacttatgtcaaaaacaattgaggatgctattgagacagatcct |
49484287 |
T |
 |
| Q |
136 |
gctggtgatatcaatagcatttctctttctttagtgaatagcgaattgttgaccaaggtcattgaatactgcaagaagcacaagaacacacaaatgtcag |
235 |
Q |
| |
|
|||||||| | ||| | ||||||||||||||||||| |||| || | ||| ||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49484286 |
actggtgatgttaattgtatttctctttctttagtgagtagcaaaatattggccatggtcattgaatactgcaagaagcacaagaacgcacaaatgtcag |
49484187 |
T |
 |
| Q |
236 |
atgttgatctcaaggattaggatgttgaattc |
267 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||| |
|
|
| T |
49484186 |
atgttgatctcatggattgggatgttgaattc |
49484155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 33 - 106
Target Start/End: Original strand, 55072058 - 55072131
Alignment:
| Q |
33 |
aaagaaaatcaacttgataagctcggatggggatgtgtttgaagttgattacgatgttgcacttatgtcaaaaa |
106 |
Q |
| |
|
||||||| |||||||| |||||||||| |||| ||||||||||||||||| | | | |||||||||||||||| |
|
|
| T |
55072058 |
aaagaaagtcaacttggtaagctcggacggggttgtgtttgaagttgatttgggtttggcacttatgtcaaaaa |
55072131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 168 - 216
Target Start/End: Original strand, 55072199 - 55072247
Alignment:
| Q |
168 |
agtgaatagcgaattgttgaccaaggtcattgaatactgcaagaagcac |
216 |
Q |
| |
|
|||||||||| || |||||| || |||| |||||||||||||||||||| |
|
|
| T |
55072199 |
agtgaatagcaaaatgttgagcatggtcgttgaatactgcaagaagcac |
55072247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University