View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21100_high_31 (Length: 268)
Name: NF21100_high_31
Description: NF21100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21100_high_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 17 - 253
Target Start/End: Complemental strand, 53128394 - 53128158
Alignment:
| Q |
17 |
atttctttggtcgacggttaatacaatcacgcacacaaacagaaggaggaggatcgtcaccttggggcgtcgcggcgctggtggtgttgcttttggtttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53128394 |
atttctttggtcgacggttaatacaatcacgcgcacaaacagaaggaggaggatcgtcaccttggggcgttgcggcgctggtggtgttgcttttggtttt |
53128295 |
T |
 |
| Q |
117 |
ggcttccaaaatctccagcttcaggtctatgtggtcgccactcatttggagaccccattagttgatgtatcgtatcatttgtaagtcataacatctatga |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
53128294 |
ggcttccaaaatctccagcttcaggtctatgtggtcgccactcatttggagaccccattagttgatgtatcatatcatttgtaagtcataacatctatga |
53128195 |
T |
 |
| Q |
217 |
aatagaaatttgtcacctatcttacgcatctgtgctc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53128194 |
aatagaaatttgtcacctatcttacgcatctgggctc |
53128158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University