View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21100_high_32 (Length: 262)
Name: NF21100_high_32
Description: NF21100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21100_high_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 11 - 246
Target Start/End: Original strand, 37035705 - 37035940
Alignment:
| Q |
11 |
caaaggaagagagcggacatgatcaatagtactagaagtatgcaggaaagagagaaggcagaattgggcaaatatcagcttttccggtctcagatgcggc |
110 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
37035705 |
caaaggaagagagcgaacataatcaatagtactagaagtatgcaggaaagagagaaggcagaattggacaaatagcagcttttccggtctcagatgcggc |
37035804 |
T |
|
| Q |
111 |
aacacccattactagtgttagcatgttatcactttccctcttttctcgcatgaggcaagcaaggcctgaaagagtgaatcgtcgaacagaaggaaggact |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
37035805 |
aacacccattactagtgttagcatgttatcactttctctcttttctcgcacgaggcaagcaaggcctgaaagagtgaatcgtcgaacaggaggaatgact |
37035904 |
T |
|
| Q |
211 |
tcgtactagggctggaatcaaagttgaaatttgttt |
246 |
Q |
| |
|
|||||| | ||||||||||||||| |||||| |||| |
|
|
| T |
37035905 |
tcgtaccaaggctggaatcaaagtggaaattcgttt |
37035940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 11 - 77
Target Start/End: Complemental strand, 21309568 - 21309502
Alignment:
| Q |
11 |
caaaggaagagagcggacatgatcaatagtactagaagtatgcaggaaagagagaaggcagaattgg |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
21309568 |
caaaggaagagagcggacatgatcaatagtactagaagtatacaggaaagagagaaggcagaattgg |
21309502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University