View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21100_high_34 (Length: 251)
Name: NF21100_high_34
Description: NF21100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21100_high_34 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 216
Target Start/End: Original strand, 53079356 - 53079553
Alignment:
| Q |
19 |
tggtacacatgcagattctttagtttaagtattaagaaaaactaaaattctaatattttccactagtgccggccggtatatcagccagcagatttttgaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53079356 |
tggtacacatgcagattctttagtttaagtattaagaaaaactaaaattctaatattttccactagtgccggccggtatatcagccagcagatttttgaa |
53079455 |
T |
|
| Q |
119 |
tagcagccaccatggtcctaatagtgaaactaggattaggatagcctcacagtgttcatagtgaattttgataaatctgataacattgtcaaccctta |
216 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53079456 |
tagcagccaccatggtcctaatagagaaactaggattaggatagcctcacagtgttcatagtgaattttgataaatctgataacattgtcaaccctta |
53079553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University