View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21100_high_51 (Length: 210)
Name: NF21100_high_51
Description: NF21100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21100_high_51 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 59 - 195
Target Start/End: Original strand, 2137791 - 2137927
Alignment:
| Q |
59 |
agttcgattcgtcaattcattgaatttcaaaattgaaataaccgaatcaatttggtttagttttctttgattcgatatttatcctttttagaaaagatca |
158 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |||||| |||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
2137791 |
agttcgattcgtcaatttattgaatttcaaaattgaaataaccgaaccaatttagtttagttttctttgatttggtatttatcctttttagaaaagatca |
2137890 |
T |
 |
| Q |
159 |
aataattttttgtttgatttaattcgggttctctctg |
195 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2137891 |
aataattttttgtttgatttaatttgggttctctctg |
2137927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University