View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21100_high_52 (Length: 210)
Name: NF21100_high_52
Description: NF21100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21100_high_52 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 63 - 195
Target Start/End: Complemental strand, 43511686 - 43511554
Alignment:
| Q |
63 |
tttcaatctttttagggaaatgcggagcatcaatccttctacctctcgcatgctacaatctttgctacatacccatatacttgtctgcctgtttaatata |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43511686 |
tttcaatctttttagggaaatgcggagcatcaatccttctacctctcgcatgctacaatcttagctacatacccatatacttgtctgcctgtttaatata |
43511587 |
T |
 |
| Q |
163 |
tatcaaagatttgatattttgttttctcatcca |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43511586 |
tatcaaagatttgatattttgttttctcatcca |
43511554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University