View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21100_low_38 (Length: 248)
Name: NF21100_low_38
Description: NF21100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21100_low_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 1 - 171
Target Start/End: Original strand, 1353205 - 1353376
Alignment:
| Q |
1 |
aaatcatagttccaacaaaaccagtagacaaaataaaaatctagggcaaatgtttatatacaattacgaattatagtcttgttttactcagtaagataaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1353205 |
aaatcatagttccaacaaaaccagtagacaaaataaaaatctagggcaaatgtatatatacaattacgaattatagtcttgttttaccaggtaagataaa |
1353304 |
T |
 |
| Q |
101 |
tcatatgggtacatgatctgtaatcgtagatcat-aatctcacgaattatattctcaaaaatatagttttcc |
171 |
Q |
| |
|
| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1353305 |
taatatgggtacatgatctgtaatcgtagatcataaatctcacgaattatattctcaaaaatatagttttcc |
1353376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University