View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21100_low_43 (Length: 236)
Name: NF21100_low_43
Description: NF21100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21100_low_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 3 - 176
Target Start/End: Original strand, 43512599 - 43512768
Alignment:
| Q |
3 |
tagaggtgcaattatttggataatctattgctgatcgatcattttatgatactttgcagcattctactgctattgatttgcttttgcatgctgttttagt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43512599 |
tagaggtgcaattatttggataatctattgctgatc----attttatgatactttgcagcattctactgctattgatttgcttttgcatggtgttttagt |
43512694 |
T |
 |
| Q |
103 |
cggaaccatttttaaggccctttgatgtttgttaagaaatataaacccaaggttgaaaagtcattattaaaaga |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43512695 |
cggaaccatttttaaggccctttgatgtttgttaagaaatttaaacccaaggttgaaaagtcattattaaaaga |
43512768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University