View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21100_low_45 (Length: 235)
Name: NF21100_low_45
Description: NF21100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21100_low_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 88 - 221
Target Start/End: Original strand, 8033151 - 8033284
Alignment:
| Q |
88 |
ctatgtcacagggagtcaatttaatcaataaacaaatctttggggctgttcccaagcacaatattgttgtttttgtccctaaacaagtggctgttcctgt |
187 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8033151 |
ctatgtcacagggagccaatttaattaataaacaaatctttggggctgttcccaagcacaatattgttgtttttgtccctaaacaagtggttgttcctgt |
8033250 |
T |
 |
| Q |
188 |
tgacagcttggttaacaacaatgaatgggtaact |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8033251 |
tgacagcttggttaacaacaatgaatgggtaact |
8033284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University