View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21100_low_51 (Length: 213)
Name: NF21100_low_51
Description: NF21100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21100_low_51 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 4e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 16 - 195
Target Start/End: Complemental strand, 52713608 - 52713429
Alignment:
| Q |
16 |
atgaaaactagatcatctaaccacaacaatttcacacattcacacgatcagtactttagaggtcatttgatcaagatcgacgatttaaatttctagttcg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52713608 |
atgaaaactagatcatctaaccacaacaatttcacacattcacacgatcagtactttagaggtcatttaatcaagatcgacgatttaaatttctagttcg |
52713509 |
T |
 |
| Q |
116 |
atannnnnnnatttaaaatcaaattctacattgcaatctggattattctgcctcataccaacggtaatgaatgtgcctcg |
195 |
Q |
| |
|
||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52713508 |
atatttttttatttaaaatcaaattctacattgaaatctggattattctgcctcataccaacggtaatgaatgtgcctcg |
52713429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 16 - 87
Target Start/End: Complemental strand, 52722295 - 52722224
Alignment:
| Q |
16 |
atgaaaactagatcatctaaccacaacaatttcacacattcacacgatcagtactttagaggtcatttgatc |
87 |
Q |
| |
|
||||||| |||| ||||||| ||||||||||||||||||||| ||||||||||| || ||||||||||||| |
|
|
| T |
52722295 |
atgaaaattagaccatctaagcacaacaatttcacacattcatacgatcagtacatttaaggtcatttgatc |
52722224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University