View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21101_low_4 (Length: 320)
Name: NF21101_low_4
Description: NF21101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21101_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 13 - 300
Target Start/End: Original strand, 37716788 - 37717080
Alignment:
| Q |
13 |
aaaattgcttaggaaaccaagtgtcaaagataactattagaaatcctagaccagcattttacaaaaagactaagaaaagtgtgattctttgcnnnnnnnn |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37716788 |
aaaattgcttaggaaaccaagtgtcaaagataactattagaaatcctagaccagcattttacaaaaagactaagaaaagtgtgattctttgccaaaaaaa |
37716887 |
T |
 |
| Q |
113 |
nntagtaag---tgtgaccaatatctccatgatgtattgtatcatcctaacatcaaaatgcatcaatagctataacatatagtagaagagtgtatgttaa |
209 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37716888 |
aaaagtaagaagtgtgaccaatatctccatgatgtattgtatcatcctaacatcaaaatgcatcaatagctataacatatagtagaagagtgtatgttaa |
37716987 |
T |
 |
| Q |
210 |
aatttcgtcttttattgtccaggaagctccatcattatcaatgtgaaccatcatccacaaacttggtc--actttcacctgaaggaaagcaag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37716988 |
aatttcgtcttttattgtccaggaagctccatcattatcaatgtgaaccatcatccacaaacttggtcaaactttcacctgaaggaaagcaag |
37717080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University