View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21101_low_6 (Length: 240)
Name: NF21101_low_6
Description: NF21101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21101_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 32430003 - 32429783
Alignment:
| Q |
1 |
cataataaagtcatcacgataattgcaacacatacaaatactattagaggccatttctttcttcattagtaaggagcttaccatgacaaactttccacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32430003 |
cataataaagtcatcacgataattgcaacacatacaaatactattagaggccgtttctttcttcattagtaaggagcttaccatgacaaactttccaaaa |
32429904 |
T |
|
| Q |
101 |
taaggaacaattactttgagggcattgc-aactgccaagctaaggggaaaataaaataacgaatcaatgttagagtcattggagagatagtgattgttgg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32429903 |
taaggaacaattactttgagggcattgcaaactgccaagctaaggggaaaataaaataacgaatcaatgttagagtgattggagagatagtgattgttga |
32429804 |
T |
|
| Q |
200 |
aacttgtgtttggggtctggt |
220 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
32429803 |
aacttgtgtttggggtctggt |
32429783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University