View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21102_low_7 (Length: 253)
Name: NF21102_low_7
Description: NF21102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21102_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 9e-88; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 13521375 - 13521196
Alignment:
| Q |
1 |
aataatttttacctcaaaatcaatcttaatcgaacagcaaacacatctatttcaacatattctttcataaatgacaccgatgtttgaataagtttgcaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13521375 |
aataatttttacctcaaaatcaatcttagtcaaacagcaaacacatctatttcaacatattctttcataaatgacaccgatgtttgaataagtttgcaga |
13521276 |
T |
 |
| Q |
101 |
atatattatctaagtcagaaaattcaccttttactttttaattcattaagaattagtcatacattacttgatgacactag |
180 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13521275 |
atatgttatctaagtcagaaaattcaccttttaccttttaattcattaagaattagtcatacattacttgatgacactag |
13521196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 197 - 240
Target Start/End: Complemental strand, 13521108 - 13521065
Alignment:
| Q |
197 |
gttcttataaatcctaattaaataaaatacatcccttccaatct |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13521108 |
gttcttataaatcctaattaaataaaatacatcccttccaatct |
13521065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University