View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21103_low_14 (Length: 279)
Name: NF21103_low_14
Description: NF21103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21103_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 6 - 262
Target Start/End: Complemental strand, 40570375 - 40570118
Alignment:
| Q |
6 |
aaaggtcctatgactgtt-gtgcctaattaaagattcgatctcacatgcaaaattcatcattcttcctgcttagggagctttcgttttgttttcttctga |
104 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40570375 |
aaaggtcctatgactgttagtgcctaattaaagattcgatctcacatgcaaaattcatcattcttcctgcttagggagctttcgttttgttttcttctga |
40570276 |
T |
 |
| Q |
105 |
ggggaatattggtaaagctatgcgatctagttctggcttttttaattaataagtaaaagtttatttagataataaagatattagtacttagtacctggat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40570275 |
ggggaatattggtaaagctatgcgatctagttctggcttttttaattaataagcaaaagtttatttagataataaagatattagtacttagtacctggat |
40570176 |
T |
 |
| Q |
205 |
caatattcaatgaagaacaaagcttaatggtgggacattgagtattccagttattaca |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40570175 |
caatattcaatgaagaacaaagcttaatggtgggacattgagtattccagttattaca |
40570118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University