View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21103_low_16 (Length: 239)
Name: NF21103_low_16
Description: NF21103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21103_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 28899634 - 28899857
Alignment:
| Q |
1 |
aatcataatcttaaatctaataagcagttaatttagacatatgacttcttacactaacaccaacccgcagccaaattgaagaggatgcagtgttccgaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
28899634 |
aatcataatcttaaatctaataagcagttaatttagacatatgacttcttatactaacaccaatccgcagccaaattgaagtggatgcagtgttctgaaa |
28899733 |
T |
|
| Q |
101 |
acaccccaaagcactcataatttatgacaccagaaagctatatattgataaataactacaagaaaaccccaaagtcatccaatttaaagtactccctttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28899734 |
acaccccaaagcactcataatttatgacaccagaaagctatatattgataaataactacaggaaaaccccaaagtcatccaatttaaagtactccctttc |
28899833 |
T |
|
| Q |
201 |
atatttcaaattttggaaccaaat |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
28899834 |
atatttcaaattttggaaccaaat |
28899857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University