View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21104_low_6 (Length: 253)
Name: NF21104_low_6
Description: NF21104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21104_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 41345131 - 41344898
Alignment:
| Q |
1 |
aatcaagaacatagtttgacgatggaaacaacttcatcatcaattcccgaaccattattgcgtcaaccaacaataaaacattatnnnnnnnccatcctag |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || ||||||||| |
|
|
| T |
41345131 |
aatcaggaacatagtttgacgatggaaacaacttcatcatcaattcccgaaccattaccgcgtcaaccaacaataaaacataataaaaaaaccatcctag |
41345032 |
T |
 |
| Q |
101 |
catggttgacagcttgcaaggaaattgatgaagggacccaggtgcgttaccatgatggggaaaaaccgataacaggtcgaattttcaatggagccatctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41345031 |
catggttgacagcttgcaaggaaattgatgaagggacccaggtgcgttaccatgatggggaaaaaccgataacaggtcgaattttcaatggagccatctt |
41344932 |
T |
 |
| Q |
201 |
atgtagctgttgcgacgaggaaatctctgtatgg |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
41344931 |
atgtagctgttgcgacgaggaaatctctgtatgg |
41344898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University