View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21104_low_7 (Length: 238)
Name: NF21104_low_7
Description: NF21104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21104_low_7 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 19 - 238
Target Start/End: Complemental strand, 8708302 - 8708083
Alignment:
| Q |
19 |
agagtccaaccagcggacaccctagaagtgctgatcattctatttcaataatgaacaacaaacggacagccgatggcagcaattgctgatatggcagaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| ||||| |||||||||||||||||||||||| || |
|
|
| T |
8708302 |
agagtccaaccagcggacaccctagaagtgccgatcattctgtttcaataatgaacaacaaacggagagccggtggcagcaattgctgatatggcagcaa |
8708203 |
T |
 |
| Q |
119 |
aattaaaacaaacacaagcacaaaacgaagatctgctgatctgctaccagaagacgcgcaagcagtagaaaaactgtgaaatcaaagccagaaccaataa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| || |||||||||||||||||||||| ||| |
|
|
| T |
8708202 |
aattaaaacaaacacaagcacaaaacgaagatctgctgatctcctaccagaagacgcacaagcagtagaacaagtgtgaaatcaaagccagaaccagtaa |
8708103 |
T |
 |
| Q |
219 |
ggcaaatcatagcacacttt |
238 |
Q |
| |
|
||||||||||| |||||||| |
|
|
| T |
8708102 |
ggcaaatcataacacacttt |
8708083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University