View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21105_high_5 (Length: 521)
Name: NF21105_high_5
Description: NF21105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21105_high_5 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 262; Significance: 1e-146; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 223 - 521
Target Start/End: Complemental strand, 44546723 - 44546425
Alignment:
| Q |
223 |
ttttgttgcacctttcaatttcctacccctacaacccttctttgaaaacacacgatttgtttgaacattacgtctctttccaccaagtttaccctttttc |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44546723 |
ttttgttgcacctttcaatttcctacccctaccacccttctttgaaaccacacgatttgtttgaacattacgtctctttccaccaagtttatcctttttc |
44546624 |
T |
 |
| Q |
323 |
tttgttgcacatgatgattcatnnnnnnnatattttacatacacatcatcctcaactatctcaagtacattagattttccatgacgcttcatatgcttca |
422 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44546623 |
tttgttgcacatgatgattcatcccccccatattttacatacacatcatcctcaactatctcaagtacattagattttccatgacgcttcatatgcttca |
44546524 |
T |
 |
| Q |
423 |
ttaaaaacctatgtcgttcattttcttcttcattgctgttgctgtcgttgttttgttcctgaagatgaagcagctgagattgtataatactggatggac |
521 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44546523 |
ataaaaacctatgtcgttcattttcttcttcattgctgttgctgtcgttgttttgttcctgaagatgaagcagctgagattgtataatactggatggac |
44546425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 3 - 230
Target Start/End: Original strand, 44547184 - 44547411
Alignment:
| Q |
3 |
aggcaatttgcttttgtacttatttggttggatttgtatgcactcaagtcatatgcccgcagttggaacattggcaggcgttgaatcaagatgctataag |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44547184 |
aggcaatttgcttttgtacttatttggttggatttgtatgcactcaagtcatatgcacgcagttggaacattggcaggcgttgaatcaagatgctataag |
44547283 |
T |
 |
| Q |
103 |
tttatttttcactgttttaatctaaaccctaaaatattgagattgaaatctagaatgtccaacttttatcaaacgtcgagtgcatgcgatccaaattggt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44547284 |
tttatttttcactgttttaatctaaaccctaaaatattgagattgaaatctagaatgtccaacttttatcaaacgtcgagtgcatgcgatccaaattggt |
44547383 |
T |
 |
| Q |
203 |
acttttctgctcgattttgtttttgttg |
230 |
Q |
| |
|
||||||||| |||||||||||||||||| |
|
|
| T |
44547384 |
acttttctggtcgattttgtttttgttg |
44547411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University