View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21105_low_9 (Length: 306)
Name: NF21105_low_9
Description: NF21105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21105_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 7 - 302
Target Start/End: Complemental strand, 7417516 - 7417221
Alignment:
| Q |
7 |
atacatgcccgatcaccaagaaacatgtgtattgatggaaagtttgttgaacctcatgtgggtcctcgagctattgctttctcactatcacatgcatata |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7417516 |
atacatgcccgatcaccaagaaacatgtgtattgatggaaagtttgttgaacctcatgtgggtcctcgagctattgctttctcactatcacatgcatata |
7417417 |
T |
 |
| Q |
107 |
taaataatgacccacacacacccttcaaactcactcacacaaccctct--aatttcacaccaaaagaaagtcacaaaatcgaccaattatggcgccagtg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7417416 |
--aataatgacccacacacacccttcaaactcactcacataaccctctctaatttcacaccaaaagaaagtcacaaaatcgaccaattatggagccagtg |
7417319 |
T |
 |
| Q |
205 |
caattattggaacttcctagttgggtcacattgtttgcaacatttgtcatcctcctcctcttcagccgccgcctccgccgccacaaatacaatctacc |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7417318 |
caattattggaacttcctagttgggtcacattgtttgcaacatttgtcatcctcctcctcttcagccgccgcctccgccgccacaaatacaatctacc |
7417221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University