View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21106_high_4 (Length: 500)
Name: NF21106_high_4
Description: NF21106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21106_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 212 - 470
Target Start/End: Complemental strand, 5041996 - 5041737
Alignment:
| Q |
212 |
atgttccatcacttcca-cataaaagcctattatttttaccaatatattgcttcttcctactttctatagtgtcattcagtttgtgctattttgcttcat |
310 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5041996 |
atgttccatcacttccaacataaaagcctattttttttaccaatatattgcttcttcctactttctatagtgtcattcagtttgtgctattttgcttcat |
5041897 |
T |
 |
| Q |
311 |
cttttacaatcagtcccttcacttctcagattctccctttctggaatacctttctctaaagaattctccctcaaatgaggaatgaatatcatcagcatgt |
410 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5041896 |
cttttacaatcagtcccttcacttctcagattctccctttcttgaacacctttctctaaagaattctccctcaaatgaggaatgaatatcatcagcatgt |
5041797 |
T |
 |
| Q |
411 |
catttgtggtcaaagattcagtttcattaccatttctcttctctttctgatagtttcaag |
470 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5041796 |
catttgtggtcaaagattcagtttcattaccatttctcttctctttctgattgtttcaag |
5041737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 104 - 151
Target Start/End: Complemental strand, 5042104 - 5042057
Alignment:
| Q |
104 |
gttttggattattgtttggatagaggctcgtcaaccaaaggagaggta |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5042104 |
gttttggattattgtttggatagaggctcgtcaaccaaaggagaggta |
5042057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University