View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21107_high_28 (Length: 259)

Name: NF21107_high_28
Description: NF21107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21107_high_28
NF21107_high_28
[»] chr8 (2 HSPs)
chr8 (167-244)||(1983996-1984073)
chr8 (4-44)||(1991515-1991555)


Alignment Details
Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 167 - 244
Target Start/End: Complemental strand, 1984073 - 1983996
Alignment:
167 gttcaacatgatcacgaaaaagatcaacttatttcccatgtcttcctctactccttagtttggaaataaagtcttcaa 244  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||| ||| |||||| ||| ||||||||||||    
1984073 gttcaacatgatcacgaaaaagatcaacttatttcccatttcttcctctaatccctagttttgaattaaagtcttcaa 1983996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 44
Target Start/End: Complemental strand, 1991555 - 1991515
Alignment:
4 atttggtgtgattaatgtgtgataagatttggtgaactcaa 44  Q
    |||||||||||||||||| |||||||||||| ||| |||||    
1991555 atttggtgtgattaatgtatgataagatttgttgagctcaa 1991515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University