View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21107_high_41 (Length: 239)
Name: NF21107_high_41
Description: NF21107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21107_high_41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 33522408 - 33522188
Alignment:
| Q |
1 |
ttattttctttccttctacgaggcgtgcacatgcagattgaatccctttttaaatcattttttgttggtgggggagaaagctcgtaaaattagttggatt |
100 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33522408 |
ttattttctttccttctacgaggtgtccacatgcagattgaatccctttttaaatcattttttgttggtgggggaggaagctcgtaaaattagttggatt |
33522309 |
T |
|
| Q |
101 |
catcgaggtaattaaggtgtattctgaaaagaagttagaattggaaatatattgttgaacatggctacatggtaaaaagagtatataatatgttcactgc |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33522308 |
catcggggtaattaaggtgtattctgaaaagaagttaggattggaaatatgttgttgaacatggctacatggtaaaaagagtctataatatgttcactgc |
33522209 |
T |
|
| Q |
201 |
taaagagcaacatgttttgtc |
221 |
Q |
| |
|
| ||||||||||||||||||| |
|
|
| T |
33522208 |
tgaagagcaacatgttttgtc |
33522188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University