View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21107_high_48 (Length: 235)
Name: NF21107_high_48
Description: NF21107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21107_high_48 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 21 - 214
Target Start/End: Complemental strand, 42066085 - 42065892
Alignment:
| Q |
21 |
ggtcggttgttatggatcatccaccaaagaggtttgtacatcggcatcggaagttatacccatgatcttacgaatgagtcaacttcttaccaattgatcc |
120 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42066085 |
ggtcggttcttatggatcgtccaccaaagaggtttgtacatcggcatcggaagttaaatccatgatcttacgaatgagtcaacttcttaccaattgatcc |
42065986 |
T |
|
| Q |
121 |
aacttttgttggcaaataaatcaaatcatgaagttagtatgatacatatgtttacatatattggtagggtagagcatatctatatctatactat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42065985 |
aacttttgttggcaaataaatcaaatcatgaagttagtatgatacatatgtttacatatattggtagggtagagtatatctatatctatactat |
42065892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 85 - 113
Target Start/End: Original strand, 3719246 - 3719274
Alignment:
| Q |
85 |
atcttacgaatgagtcaacttcttaccaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3719246 |
atcttacgaatgagtcaacttcttaccaa |
3719274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University