View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21107_high_49 (Length: 219)

Name: NF21107_high_49
Description: NF21107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21107_high_49
NF21107_high_49
[»] chr7 (1 HSPs)
chr7 (18-201)||(40213966-40214149)


Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 201
Target Start/End: Original strand, 40213966 - 40214149
Alignment:
18 agatatatatgctttctaaagtaatagttctagatattaaattagtgttggattggatgttttattttttcacaagcaaaaatgatttatcaatattcat 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
40213966 agatatatatgctttctaaagtaatagttctagatattaaattagtgttggattggatgttttattttttcacaagcaaaaacgatttatcaatattcat 40214065  T
118 ttatgctaattctcctgcactgaccctttattatattatttgtatgaatattatttatttctgccatgcatgcagggaacaaat 201  Q
    ||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
40214066 ttatgctaattctcctgcactgaacctttattatattatttctatgaatattatttatttctgccatgcatgcagggaacaaat 40214149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University