View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21107_low_21 (Length: 336)
Name: NF21107_low_21
Description: NF21107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21107_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 321
Target Start/End: Original strand, 13799940 - 13800259
Alignment:
| Q |
1 |
ccgagtgagttgttcaattacatttatttaaaggtttataatagatgggtcagattttcactattgcattttatctctctttggaaaaagtgcatgttat |
100 |
Q |
| |
|
|||| |||||||||||| |||||||||||| ||||||||||||||||| || ||||||| |||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
13799940 |
ccgattgagttgttcaactacatttatttagaggtttataatagatggaccat-ttttcacaattgtattttatatctctttggaaaaagtgcatgttat |
13800038 |
T |
|
| Q |
101 |
ctcatatctgaatcgaactcttggcaccgaaaaacaaatcaatttagacttttatcctcttaagtttaattcgataaacatttgaaatatccaaattgac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13800039 |
ctcatatctgaatcgaactcttggcaccgaaaaacaaatcaatttagacttttatcctcgtaagtttcattcgataaacatttgaaatatccaaattgac |
13800138 |
T |
|
| Q |
201 |
tattgattcatgaaattgaatcccccattgtgatatgattggggtacgaaatgctcccaaattgtggaagtaatcgatgacgaggaaaggtatttgattc |
300 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13800139 |
tattgattcatgaaattgaatcccccagtgtgatatgattggggtacgcaatgctcccaaattgtggaagtaatcgatgacgaggaaaggtatttgattc |
13800238 |
T |
|
| Q |
301 |
tttggtttattgggtcgaatc |
321 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
13800239 |
tttggtttattgggtcgaatc |
13800259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University