View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21107_low_22 (Length: 322)
Name: NF21107_low_22
Description: NF21107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21107_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 208 - 303
Target Start/End: Complemental strand, 1539776 - 1539681
Alignment:
| Q |
208 |
atcctaggtttgtgatatgacagtgatgaataattgtttttgtttacagtgtctatcgcccctgttggtgctgctactcctggtatgtttccttat |
303 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1539776 |
atcctaggtttgtgacatgacagtgatgaataattgtttttgtttacagtgtctatcgcccctgttggtgctgctactcctggtatgtttccttat |
1539681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 13 - 85
Target Start/End: Complemental strand, 1539845 - 1539773
Alignment:
| Q |
13 |
cacagacacaatttagtgtaatcacatgtctcggcgtcagtccgtgtgtctgacaccaggacacttctaatcc |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
1539845 |
cacagacacaatttagtgtaatcacatgtctcggcgtcggtccgtgtgtctgacactgggacacttctaatcc |
1539773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University